CRISPResso2

Failed Guardrails (3)

Guardrail Warning! <=90.0% of reads were aligned. Total reads: 25000, Aligned reads: 15668.

Guardrail Warning! >=1.0% of reads have modifications at the start or end. Total reads: 15668, Irregular reads: 15668.

Guardrail Warning! >=0.2% of substitutions were outside of the quantification window. Total substitutions: 4587, Substitutions outside window: 2029.

Passed Guardrails (6)

Guardrail Passed: Total reads (25000) above minimum threshold (10000).

Guardrail Passed: Sufficient ratio of modifications inside quantification window.

Guardrail Passed: Substitution rate within acceptable range.

Guardrail Passed: All amplicon lengths above minimum threshold (50).

Guardrail Passed: All guide lengths above minimum threshold (19).

Guardrail Passed: Amplicon lengths within acceptable range of read lengths.

FANCF_BE1

Alignment

Figure 1a: The number of reads in input fastqs, after preprocessing, and after alignment to amplicons.

Data: Mapping statistics

Figure 1e: Distribution of read alignment homology scores, showing the best-scoring alignment of each sequencing read to the provided amplicons. The dashed line indicates the minimum alignment score threshold used to discard low-quality alignments.

Data: Alleles Frequency Table

CRISPResso version: 2.3.4

Run completed: 2026-09-17 19:10:42

Amplicon sequence:

CATTGCAGAGAGGCGTATCATTTCGCGGATGTTCCAATCAGTACGCAGAGAGTCGCCGTCTCCAAGGTGAAAGCGGAAGTAGGGCCTTCGCGCACCTCATGGAATCCCTTCTGCAGCACCTGGATCGCTTTTCCGAGCTTCTGGCGGTCTCAAGCACTACCTACGTCAGCACCTGGGACCCC

Guide sequence:

GGAATCCCTTCTGCAGCACC

Command used:

CRISPResso -o CRISPRessoBatch_on_batch --name FANCF_BE1 --conversion_nuc_to T --quantification_window_center -10 --min_bp_quality_or_N 0 --aln_seed_count 5 --flash_command None --min_paired_end_reads_overlap 10 --flexiguide_homology 80 --exclude_bp_from_left 15 --place_report_in_output_folder --verbosity 3 --aln_seed_min 2 --write_cleaned_report --aln_seed_len 10 --quantification_window_size 20 --amplicon_seq CATTGCAGAGAGGCGTATCATTTCGCGGATGTTCCAATCAGTACGCAGAGAGTCGCCGTCTCCAAGGTGAAAGCGGAAGTAGGGCCTTCGCGCACCTCATGGAATCCCTTCTGCAGCACCTGGATCGCTTTTCCGAGCTTCTGGCGGTCTCAAGCACTACCTACGTCAGCACCTGGGACCCC --needleman_wunsch_gap_open -20 --base_editor_target_ref_skip_allele_count 0 --fastp_command fastp --config_file None --needleman_wunsch_aln_matrix_loc EDNAFULL --default_min_aln_score 60 --exclude_bp_from_right 15 --min_average_read_quality 0 --amplicon_name Reference --max_rows_alleles_around_cut_to_plot 50 --needleman_wunsch_gap_incentive 1 --prime_editing_pegRNA_scaffold_min_match_length 1 --config_json None --max_paired_end_reads_overlap None --min_single_bp_quality 0 --needleman_wunsch_gap_extend -2 --flexiguide_gap_extend_penalty -2 --trimmomatic_command None --guide_seq GGAATCCCTTCTGCAGCACC --prime_editing_pegRNA_extension_quantification_window_size 5 --fastq_r1 SRR3305543.fastq.gz --min_frequency_alleles_around_cut_to_plot 0.2 --conversion_nuc_from C --plot_window_size 20 --flexiguide_seq None --n_processes 1 --flexiguide_gap_open_penalty -20 --prime_editing_gap_open_penalty -50 --base_editor_output --prime_editing_gap_extend_penalty 0

Parameters:

allele_plot_pcts_only_for_assigned_reference: False
aln_seed_count: 5
aln_seed_len: 10
aln_seed_min: 2
amplicon_coordinates: 
amplicon_min_alignment_score: 
amplicon_name: Reference
amplicon_seq: CATTGCAGAGAGGCGTATCATTTCGCGGATGTTCCAATCAGTACGCAGAGAGTCGCCGTCTCCAAGGTGAAAGCGGAAGTAGGGCCTTCGCGCACCTCATGGAATCCCTTCTGCAGCACCTGGATCGCTTTTCCGAGCTTCTGGCGGTCTCAAGCACTACCTACGTCAGCACCTGGGACCCC
annotate_wildtype_allele: 
assign_ambiguous_alignments_to_first_reference: False
auto: False
bam_chr_loc: 
bam_input: 
bam_output: False
base_editor_consider_changes_outside_qw: False
base_editor_output: True
base_editor_target_ref_skip_allele_count: 0
bowtie2_index: 
coding_seq: 
coding_seq_name: 
config_file: None
config_json: None
conversion_nuc_from: C
conversion_nuc_to: T
crispresso1_mode: False
crispresso_merge: False
debug: False
default_min_aln_score: 60
disable_guardrails: False
discard_guide_positions_overhanging_amplicon_edge: False
discard_indel_reads: False
display_name: 
dsODN: 
dump: False
exclude_bp_from_left: 15
exclude_bp_from_right: 15
expand_allele_plots_by_quantification: False
expand_ambiguous_alignments: False
expected_hdr_amplicon_seq: 
fastp_command: fastp
fastp_options_string: 
fastq_output: False
fastq_r1: SRR3305543.fastq.gz
fastq_r2: 
file_prefix: 
flash_command: None
flexiguide_gap_extend_penalty: -2
flexiguide_gap_open_penalty: -20
flexiguide_homology: 80
flexiguide_name: 
flexiguide_seq: None
force_merge_pairs: False
guide_name: 
guide_seq: GGAATCCCTTCTGCAGCACC
halt_on_plot_fail: False
ignore_deletions: False
ignore_insertions: False
ignore_substitutions: False
keep_intermediate: False
list_plots: False
max_paired_end_reads_overlap: None
max_rows_alleles_around_cut_to_plot: 50
min_average_read_quality: 0
min_bp_quality_or_N: 0
min_frequency_alleles_around_cut_to_plot: 0.2
min_paired_end_reads_overlap: 10
min_single_bp_quality: 0
n_processes: 1
name: FANCF_BE1
needleman_wunsch_aln_matrix_loc: EDNAFULL
needleman_wunsch_gap_extend: -2
needleman_wunsch_gap_incentive: 1
needleman_wunsch_gap_open: -20
no_rerun: False
output_folder: CRISPRessoBatch_on_batch
place_report_in_output_folder: True
plot_histogram_outliers: False
plot_window_size: 20
prime_editing_gap_extend_penalty: 0
prime_editing_gap_open_penalty: -50
prime_editing_nicking_guide_seq: 
prime_editing_override_prime_edited_ref_seq: 
prime_editing_override_sequence_checks: False
prime_editing_pegRNA_extension_quantification_window_size: 5
prime_editing_pegRNA_extension_seq: 
prime_editing_pegRNA_scaffold_min_match_length: 1
prime_editing_pegRNA_scaffold_seq: 
prime_editing_pegRNA_spacer_seq: 
quantification_window_center: -10
quantification_window_coordinates: None
quantification_window_size: 20
samtools_exclude_flags: 0
save_also_png: False
split_interleaved_input: False
stringent_flash_merging: False
suppress_amplicon_name_truncation: False
suppress_plots: False
suppress_report: False
trim_sequences: False
trimmomatic_command: None
trimmomatic_options_string: 
use_legacy_insertion_quantification: False
use_matplotlib: False
vcf_output: False
verbosity: 3
write_cleaned_report: True
write_detailed_allele_table: False
zip_output: False

Running log

Allele Assignments

Figure 1b: Alignment and editing frequency of reads as determined by the percentage and number of sequence reads showing unmodified and modified alleles.

Data: Quantification of editing

Figure 1c: Alignment and editing frequency of reads as determined by the percentage and number of sequence reads showing unmodified and modified alleles.

Data: Quantification of editing

Nucleotide Composition

Figure 2a: Nucleotide distribution across amplicon. At each base in the reference amplicon, the percentage of each base as observed in sequencing reads is shown (A = green; C = orange; G = yellow; T = purple). Black bars show the percentage of reads for which that base was deleted. Brown bars between bases show the percentage of reads having an insertion at that position.

Data: Nucleotide frequency table

Figure 2b: Nucleotide distribution around the sgRNA GGAATCCCTTCTGCAGCACC.

Data: Nucleotide frequency in quantification window

Modification Lengths

Figure 3a: Frequency distribution of alleles with indels (blue) and without indels (red). Note that histograms are clipped to show 99% of the data. To show all data, run using the parameter '--plot_histogram_outliers'. (Minimum -53 not shown)

Data: Indel histogram

Figure 3b: Left panel, frequency distribution of sequence modifications that increase read length with respect to the reference amplicon, classified as insertions (positive indel size). Middle panel, frequency distribution of sequence modifications that reduce read length with respect to the reference amplicon, classified as deletions (negative indel size). Right panel, frequency distribution of sequence modifications that do not alter read length with respect to the reference amplicon, which are classified as substitutions (number of substituted positions shown). Note that histograms are clipped to show 99% of the data. To show all data, run using the parameter '--plot_histogram_outliers'. (Deletion minimum -53 not shown)

Data: Insertions frequency

Data: Deletions Frequency

Data: Substitutions Frequency

Indel Characterization

Figure 4a: Combined frequency of any modification across the amplicon. Modifications outside of the quantification window are also shown.

Data: Combined modification frequency

Figure 4b: Frequency of insertions, deletions, and substitutions across the entire amplicon, including modifications outside of the quantification window.

Data: Modification frequency

Figure 4c: Frequency of insertions, deletions, and substitutions across the entire amplicon, considering only modifications that overlap with the quantification window.

Data: Modification frequency in quantification window

Figure 4d: Position dependent insertion size(left) and deletion size (right), including only modifications that overlap with the quantification window.

Allele Plots

Figure 9: Interactive visualization of the distribution of identified alleles around the cleavage site for the sgRNA GGAATCCCTTCTGCAGCACC. Nucleotides are indicated by unique colors (A = green; C = orange; G = yellow; T = purple). Bases matching the reference are faded and unlabelled, so only differences are highlighted. Dark cells indicate deleted sequences, and a green rule beneath a position indicates an inserted sequence. The dashed rectangle indicates the quantification window. Alleles are sorted by frequency and only the most frequent matches are drawn, but the search box filters every allele in the table -- by sequence motif, which also matches across deletion gaps, or by edit class.

Data: Allele frequency table

Substitution Analysis

Figure 10a: Substitution frequencies across the amplicon.

Figure 10b: Substitution frequencies across the amplicon.

Data: Nucleotide frequencies

Figure 10c: Substitution frequencies in the quantification window

Data: Nucleotide frequencies in quantification window

Figure 10d: Log2 nucleotide frequencies for each position in the plotting window around the sgRNA GGAATCCCTTCTGCAGCACC. The quantification window is outlined by the dotted box.

Data: Nucleotide frequencies in quantification window

Figure 10e: Proportion of each base at each nucleotide targeted by base editors in the plotting window around the sgRNA GGAATCCCTTCTGCAGCACC. The number of each target base is annotated on the reference sequence at the bottom of the plot.

Data: Nucleotide frequencies at Cs

Figure 10f: Non-reference base proportions. For target nucleotides in the plotting window, this plot shows the proportion of non-reference (non-C) bases as a percentage of all non-reference sequences. The number of each target base is annotated on the reference sequence at the bottom of the plot.

Data: Nucleotide frequencies at Cs

Figure 10g: Non-reference base counts. For target nucleotides in the plotting window, this plot shows the number of non-reference (non-C) bases. The number of each target base is annotated on the reference sequence at the bottom of the plot.

Data: Nucleotide frequencies at Cs

Figure 10h: Quilt of target nucleotide: C across entire amplicon. The x-axis shows the corresponding position of the nucleotide in the reference amplicon (1-indexed). Nucleotides are indicated by unique colors (A = green; C = red; G = yellow; T = purple). Substitutions are shown in bold font. Red rectangles highlight inserted sequences. Horizontal dashed lines indicate deleted sequences.

Figure 10i: Upset plot of Base Edits for C around cut site for sgRNA GGAATCCCTTCTGCAGCACC. Each dot matrix at the bottom represents a specific combination of base edits (colored by target position), and the bar plot at the top shows the number of reads with each combination.

CRISPResso2

Analysis of genome editing outcomes from deep sequencing data

FANCF_BE1

Alignment

Allele Assignments

Nucleotide Composition

Modification Lengths

Indel Characterization

Allele Plots

Substitution Analysis