CRISPResso version 2.3.2 [Command used]: /opt/conda/bin/CRISPResso -o /var/www/webapps/CRISPRessoWEB/CRISPRessoWEB/static/demo/CRISPRessoBatch_on_batch --name FANCF_BE1 --min_paired_end_reads_overlap 10 --quantification_window_size 20 --base_editor_output --fastp_command fastp --flexiguide_gap_extend_penalty -2 --prime_editing_gap_extend_penalty 0 --plot_window_size 20 --exclude_bp_from_right 15 --flash_command None --exclude_bp_from_left 15 --verbosity 3 --aln_seed_len 10 --n_processes 1 --amplicon_seq CATTGCAGAGAGGCGTATCATTTCGCGGATGTTCCAATCAGTACGCAGAGAGTCGCCGTCTCCAAGGTGAAAGCGGAAGTAGGGCCTTCGCGCACCTCATGGAATCCCTTCTGCAGCACCTGGATCGCTTTTCCGAGCTTCTGGCGGTCTCAAGCACTACCTACGTCAGCACCTGGGACCCC --min_bp_quality_or_N 0 --amplicon_name Reference --flexiguide_homology 80 --needleman_wunsch_gap_extend -2 --prime_editing_pegRNA_extension_quantification_window_size 5 --min_average_read_quality 0 --needleman_wunsch_aln_matrix_loc EDNAFULL --needleman_wunsch_gap_incentive 1 --max_rows_alleles_around_cut_to_plot 50 --prime_editing_gap_open_penalty -50 --place_report_in_output_folder --quantification_window_center -10 --conversion_nuc_from C --conversion_nuc_to T --write_cleaned_report --guide_seq GGAATCCCTTCTGCAGCACC --trimmomatic_command None --prime_editing_pegRNA_scaffold_min_match_length 1 --needleman_wunsch_gap_open -20 --min_frequency_alleles_around_cut_to_plot 0.2 --default_min_aln_score 60 --config_file None --aln_seed_min 2 --max_paired_end_reads_overlap None --flexiguide_seq None --min_single_bp_quality 0 --aln_seed_count 5 --fastq_r1 SRR3305543.fastq.gz --flexiguide_gap_open_penalty -20 [Execution log]: CRISPRessoPro not installed Computing quantification windows Added 0 guides with flexible matching Original flexiguides: ['None'] Found guides: [] Mismatch locations: [] Aligning sequences... Finished reading fastq file; 4282 unique reads found of 25000 total reads found Processing Reads; 0 Completed out of 4282 Unique Reads Finished reads; N_TOT_READS: 25000 N_COMPUTED_ALN: 2682 N_CACHED_ALN: 12986 N_COMPUTED_NOTALN: 1600 N_CACHED_NOTALN: 7732 Done! Quantifying indels/substitutions... Done! Calculating allele frequencies... Done! Saving processed data... Making Plots... Plotting read bar plot Plotting read class pie chart and bar plot Begin processing plots for amplicon Reference Plotting nucleotide quilt across amplicon Plotting nucleotide distribuition around sgRNA GGAATCCCTTCTGCAGCACC for Reference Plotting indel size distribution for Reference Plotting frequency deletions/insertions for Reference Plotting amplication modifications for Reference Plotting modification frequency for Reference Plotting quantification window locations for Reference Plotting position dependent indel for Reference Plotting substitutions across reference for Reference Plotting substitution frequency barplot for Reference Plotting substitution frequency barplot in quantification window for Reference Plotting allele distribution around cut for Reference Plotting log2 nucleotide frequency for Reference Plotting conversion at Cs around the sgRNA GGAATCCCTTCTGCAGCACC for Reference Plotting non-reference conversion at Cs around the sgRNA GGAATCCCTTCTGCAGCACC for Reference Plotting scaled non-reference conversion at Cs around the sgRNA GGAATCCCTTCTGCAGCACC for Reference Done! Done! Removing Intermediate files... <=90.0% of reads were aligned. Total reads: 25000, Aligned reads: 15668. >=1.0% of reads have modifications at the start or end. Total reads: 15668, Irregular reads: 15668. >=0.2% of substitutions were outside of the quantification window. Total substitutions: 4587, Substitutions outside window: 2029. Analysis Complete! _ ' ) .-' (____ C)| \ \ / \___/