CRISPResso2

Guardrail Warning! Disproportionate percentages of reads were aligned to amplicon: Reference, Percent of aligned reads aligned to this amplicon: 57.59%.

Guardrail Warning! Disproportionate percentages of reads were aligned to amplicon: Prime-edited, Percent of aligned reads aligned to this amplicon: 38.94%.

Guardrail Warning! Disproportionate percentages of reads were aligned to amplicon: Scaffold-incorporated, Percent of aligned reads aligned to this amplicon: 2.12%.

Guardrail Warning! >=1.0% of reads have modifications at the start or end. Total reads: 24911, Irregular reads: 24907.

Guardrail Warning! >=0.2% of substitutions were outside of the quantification window. Total substitutions: 6550, Substitutions outside window: 5668.

CRISPResso2 run information

Figure 1a: The number of reads in input fastqs, after preprocessing, and after alignment to amplicons.

Data: Mapping statistics

CRISPResso version: 2.3.2

Run completed: 2025-04-25 21:37:06

Amplicon sequence:

ACGTCTCATATGCCCCTTGGCAGTCATCTTAGTCATTACCTGAGGTGTTCGTTGTAACTCATATAAACTGAGTTCCCATGTTTTGCTTAATGGTTGAGTTCCGTTTGTCTGCACAGCCTGAGACATTGCTGGAAATAAAGAAGAGAGAAAAACAATTTTAGTATTTGGAAGGGAAGTGCTATGGTCTGAATGTATGTGTCCCACCAAAATTCCTACGT

Command used:

CRISPResso --fastq_r1 prime_editor.fastq.gz --amplicon_seq ACGTCTCATATGCCCCTTGGCAGTCATCTTAGTCATTACCTGAGGTGTTCGTTGTAACTCATATAAACTGAGTTCCCATGTTTTGCTTAATGGTTGAGTTCCGTTTGTCTGCACAGCCTGAGACATTGCTGGAAATAAAGAAGAGAGAAAAACAATTTTAGTATTTGGAAGGGAAGTGCTATGGTCTGAATGTATGTGTCCCACCAAAATTCCTACGT --prime_editing_pegRNA_spacer_seq GTCATCTTAGTCATTACCTG --prime_editing_pegRNA_extension_seq AACGAACACCTCATGTAATGACTAAGATG --prime_editing_nicking_guide_seq CTCAACCATTAAGCAAAACAT --prime_editing_pegRNA_scaffold_seq GTTTTAGAGCTAGAAATAGCAAGTTAAAATAAGGCTAGTCCGTTATCAACTTGAAAAAGTGGCACCGAGTCGGTGC --write_cleaned_report --place_report_in_output_folder

Parameters:

allele_plot_pcts_only_for_assigned_reference: False
aln_seed_count: 5
aln_seed_len: 10
aln_seed_min: 2
amplicon_min_alignment_score: 
amplicon_name: Reference
amplicon_seq: ACGTCTCATATGCCCCTTGGCAGTCATCTTAGTCATTACCTGAGGTGTTCGTTGTAACTCATATAAACTGAGTTCCCATGTTTTGCTTAATGGTTGAGTTCCGTTTGTCTGCACAGCCTGAGACATTGCTGGAAATAAAGAAGAGAGAAAAACAATTTTAGTATTTGGAAGGGAAGTGCTATGGTCTGAATGTATGTGTCCCACCAAAATTCCTACGT
annotate_wildtype_allele: 
assign_ambiguous_alignments_to_first_reference: False
auto: False
bam_chr_loc: 
bam_input: 
bam_output: False
base_editor_output: False
bowtie2_index: 
coding_seq: 
config_file: None
conversion_nuc_from: C
conversion_nuc_to: T
crispresso1_mode: False
debug: False
default_min_aln_score: 60
disable_guardrails: False
discard_guide_positions_overhanging_amplicon_edge: False
discard_indel_reads: False
dsODN: 
dump: False
exclude_bp_from_left: 15
exclude_bp_from_right: 15
expand_allele_plots_by_quantification: False
expand_ambiguous_alignments: False
expected_hdr_amplicon_seq: 
fastp_command: fastp
fastp_options_string: 
fastq_output: False
fastq_r1: prime_editor.fastq.gz
fastq_r2: 
file_prefix: 
flash_command: None
flexiguide_gap_extend_penalty: -2
flexiguide_gap_open_penalty: -20
flexiguide_homology: 80
flexiguide_name: 
flexiguide_seq: None
force_merge_pairs: False
guide_name: 
guide_seq: 
halt_on_plot_fail: False
ignore_deletions: False
ignore_insertions: False
ignore_substitutions: False
keep_intermediate: False
max_paired_end_reads_overlap: None
max_rows_alleles_around_cut_to_plot: 50
min_average_read_quality: 0
min_bp_quality_or_N: 0
min_frequency_alleles_around_cut_to_plot: 0.2
min_paired_end_reads_overlap: 10
min_single_bp_quality: 0
n_processes: 1
name: 
needleman_wunsch_aln_matrix_loc: EDNAFULL
needleman_wunsch_gap_extend: -2
needleman_wunsch_gap_incentive: 1
needleman_wunsch_gap_open: -20
no_rerun: False
output_folder: 
place_report_in_output_folder: True
plot_histogram_outliers: False
plot_window_size: 20
prime_editing_gap_extend_penalty: 0
prime_editing_gap_open_penalty: -50
prime_editing_nicking_guide_seq: CTCAACCATTAAGCAAAACAT
prime_editing_override_prime_edited_ref_seq: 
prime_editing_override_sequence_checks: False
prime_editing_pegRNA_extension_quantification_window_size: 5
prime_editing_pegRNA_extension_seq: AACGAACACCTCATGTAATGACTAAGATG
prime_editing_pegRNA_scaffold_min_match_length: 1
prime_editing_pegRNA_scaffold_seq: GTTTTAGAGCTAGAAATAGCAAGTTAAAATAAGGCTAGTCCGTTATCAACTTGAAAAAGTGGCACCGAGTCGGTGC
prime_editing_pegRNA_spacer_seq: GTCATCTTAGTCATTACCTG
quantification_window_center: -3
quantification_window_coordinates: None
quantification_window_size: 1
samtools_exclude_flags: 0
save_also_png: False
split_interleaved_input: False
stringent_flash_merging: False
suppress_amplicon_name_truncation: False
suppress_plots: False
suppress_report: False
trim_sequences: False
trimmomatic_command: None
trimmomatic_options_string: 
use_legacy_insertion_quantification: False
use_matplotlib: False
verbosity: 3
write_cleaned_report: True
write_detailed_allele_table: False
zip_output: False

Running log

Allele assignments

Figure 1b: Alignment and editing frequency of reads as determined by the percentage and number of sequence reads showing unmodified and modified alleles.

Data: Quantification of editing

Figure 1c: Alignment and editing frequency of reads as determined by the percentage and number of sequence reads showing unmodified and modified alleles.

Data: Quantification of editing

Prime editing report (all reads aligned to Reference)

Figure 11a: Nucleotide distribution across all amplicons. At each base in the reference amplicon, the percentage of each base as observed in sequencing reads is shown (A = green; C = orange; G = yellow; T = purple). Black bars show the percentage of reads for which that base was deleted. Brown bars between bases show the percentage of reads having an insertion at that position.

Data: Nucleotide frequency table for Reference

Data: Nucleotide frequency table for Prime-edited

Data: Nucleotide frequency table for Scaffold-incorporated

Prime editing summary plots at analysis positions (aligned to Reference)

Figure 11b: Nucleotide distribution around the PE Extension (AACGAACACCTCATGTAATGACTAAGATG).

Data: Nucleotide frequency in quantification window for Reference

Data: Nucleotide frequency in quantification window for Prime-edited

Data: Nucleotide frequency in quantification window for Scaffold-incorporated

Figure 11b: Nucleotide distribution around the PE spacer sgRNA (GTCATCTTAGTCATTACCTG).

Data: Nucleotide frequency in quantification window for Reference

Data: Nucleotide frequency in quantification window for Prime-edited

Data: Nucleotide frequency in quantification window for Scaffold-incorporated

Figure 11b: Nucleotide distribution around the PE nicking sgRNA (CTCAACCATTAAGCAAAACAT).

Data: Nucleotide frequency in quantification window for Reference

Data: Nucleotide frequency in quantification window for Prime-edited

Data: Nucleotide frequency in quantification window for Scaffold-incorporated

Scaffold insertions

Figure 11c: Scaffold insertion lengths and deletion lengths in reads that contain a scaffold insertion. 'Length matching scaffold' shows the number of basepairs immediately after the pegRNA extension sequence that exactly match the scaffold RNA sequence. 'Insertion length' shows the length of the insertion immediately after the pegRNA extension sequence (including bases that do not match the scaffold sequence).

Data: Scaffold insertion alleles with insertion sizes

Amplicons

Reads aligning to Reference

Nucleotide composition for Reference

Hover your mouse over the bottom image to zoom in on a specific region.
Figure 2a: Nucleotide distribution across amplicon. At each base in the reference amplicon, the percentage of each base as observed in sequencing reads is shown (A = green; C = orange; G = yellow; T = purple). Black bars show the percentage of reads for which that base was deleted. Brown bars between bases show the percentage of reads having an insertion at that position.

Data: Nucleotide frequency table

Figure 2b: Nucleotide distribution around the PE Extension (AACGAACACCTCATGTAATGACTAAGATG).

Data: Nucleotide frequency in quantification window

Figure 2b: Nucleotide distribution around the PE spacer sgRNA (GTCATCTTAGTCATTACCTG).

Data: Nucleotide frequency in quantification window

Figure 2b: Nucleotide distribution around the PE nicking sgRNA (CTCAACCATTAAGCAAAACAT).

Data: Nucleotide frequency in quantification window

Modification lengths for Reference

Figure 3a: Frequency distribution of alleles with indels (blue) and without indels (red). Note that histograms are clipped to show 99% of the data. To show all data, run using the parameter '--plot_histogram_outliers'. (Maximum 57 not shown) (Minimum -84 not shown)

Data: Indel histogram

Figure 3b: Left panel, frequency distribution of sequence modifications that increase read length with respect to the reference amplicon, classified as insertions (positive indel size). Middle panel, frequency distribution of sequence modifications that reduce read length with respect to the reference amplicon, classified as deletions (negative indel size). Right panel, frequency distribution of sequence modifications that do not alter read length with respect to the reference amplicon, which are classified as substitutions (number of substituted positions shown).

Data: Insertions frequency

Data: Deletions Frequency

Data: Substitutions Frequency

Indel characterization for Reference

Figure 4a: Combined frequency of any modification across the amplicon. Modifications outside of the quantification window are also shown.

Figure 4b: Frequency of insertions, deletions, and substitutions across the entire amplicon, including modifications outside of the quantification window.

Data: Modification frequency

Figure 4c: Frequency of insertions, deletions, and substitutions across the entire amplicon, considering only modifications that overlap with the quantification window.

Data: Modification frequency in quantification window

Figure 4d: Position dependent insertion size(left) and deletion size (right), including only modifications that overlap with the quantification window.

Allele plots for Reference

Figure 9: Visualization of the distribution of identified alleles around the cleavage site for the PE Extension (AACGAACACCTCATGTAATGACTAAGATG). Nucleotides are indicated by unique colors (A = green; C = red; G = yellow; T = purple). Substitutions are shown in bold font. Red rectangles highlight inserted sequences. Horizontal dashed lines indicate deleted sequences. The vertical dashed line indicates the predicted cleavage site.

Data: Allele frequency table

Figure 9: Visualization of the distribution of identified alleles around the cleavage site for the PE spacer sgRNA (GTCATCTTAGTCATTACCTG). Nucleotides are indicated by unique colors (A = green; C = red; G = yellow; T = purple). Substitutions are shown in bold font. Red rectangles highlight inserted sequences. Horizontal dashed lines indicate deleted sequences. The vertical dashed line indicates the predicted cleavage site.

Data: Allele frequency table

Figure 9: Visualization of the distribution of identified alleles around the cleavage site for the PE nicking sgRNA (CTCAACCATTAAGCAAAACAT). Nucleotides are indicated by unique colors (A = green; C = red; G = yellow; T = purple). Substitutions are shown in bold font. Red rectangles highlight inserted sequences. Horizontal dashed lines indicate deleted sequences. The vertical dashed line indicates the predicted cleavage site.

Data: Allele frequency table

Reads aligning to Prime-edited

Nucleotide composition for Prime-edited

Hover your mouse over the bottom image to zoom in on a specific region.
Figure 2a: Nucleotide distribution across amplicon. At each base in the reference amplicon, the percentage of each base as observed in sequencing reads is shown (A = green; C = orange; G = yellow; T = purple). Black bars show the percentage of reads for which that base was deleted. Brown bars between bases show the percentage of reads having an insertion at that position.

Data: Nucleotide frequency table

Figure 2b: Nucleotide distribution around the PE Extension (AACGAACACCTCATGTAATGACTAAGATG).

Data: Nucleotide frequency in quantification window

Figure 2b: Nucleotide distribution around the PE spacer sgRNA (GTCATCTTAGTCATTACCTG).

Data: Nucleotide frequency in quantification window

Figure 2b: Nucleotide distribution around the PE nicking sgRNA (CTCAACCATTAAGCAAAACAT).

Data: Nucleotide frequency in quantification window

Modification lengths for Prime-edited

Figure 3a: Frequency distribution of alleles with indels (blue) and without indels (red). Note that histograms are clipped to show 99% of the data. To show all data, run using the parameter '--plot_histogram_outliers'. (Maximum 61 not shown) (Minimum -84 not shown)

Data: Indel histogram

Figure 3b: Left panel, frequency distribution of sequence modifications that increase read length with respect to the reference amplicon, classified as insertions (positive indel size). Middle panel, frequency distribution of sequence modifications that reduce read length with respect to the reference amplicon, classified as deletions (negative indel size). Right panel, frequency distribution of sequence modifications that do not alter read length with respect to the reference amplicon, which are classified as substitutions (number of substituted positions shown).

Data: Insertions frequency

Data: Deletions Frequency

Data: Substitutions Frequency

Indel characterization for Prime-edited

Figure 4a: Combined frequency of any modification across the amplicon. Modifications outside of the quantification window are also shown.

Figure 4b: Frequency of insertions, deletions, and substitutions across the entire amplicon, including modifications outside of the quantification window.

Data: Modification frequency

Figure 4c: Frequency of insertions, deletions, and substitutions across the entire amplicon, considering only modifications that overlap with the quantification window.

Data: Modification frequency in quantification window

Figure 4d: Position dependent insertion size(left) and deletion size (right), including only modifications that overlap with the quantification window.

Allele plots for Prime-edited

Figure 9: Visualization of the distribution of identified alleles around the cleavage site for the PE Extension (AACGAACACCTCATGTAATGACTAAGATG). Nucleotides are indicated by unique colors (A = green; C = red; G = yellow; T = purple). Substitutions are shown in bold font. Red rectangles highlight inserted sequences. Horizontal dashed lines indicate deleted sequences. The vertical dashed line indicates the predicted cleavage site.

Data: Allele frequency table

Figure 9: Visualization of the distribution of identified alleles around the cleavage site for the PE spacer sgRNA (GTCATCTTAGTCATTACCTG). Nucleotides are indicated by unique colors (A = green; C = red; G = yellow; T = purple). Substitutions are shown in bold font. Red rectangles highlight inserted sequences. Horizontal dashed lines indicate deleted sequences. The vertical dashed line indicates the predicted cleavage site.

Data: Allele frequency table

Figure 9: Visualization of the distribution of identified alleles around the cleavage site for the PE nicking sgRNA (CTCAACCATTAAGCAAAACAT). Nucleotides are indicated by unique colors (A = green; C = red; G = yellow; T = purple). Substitutions are shown in bold font. Red rectangles highlight inserted sequences. Horizontal dashed lines indicate deleted sequences. The vertical dashed line indicates the predicted cleavage site.

Data: Allele frequency table

Reads aligning to Scaffold-incorporated

Nucleotide composition for Scaffold-incorporated

Hover your mouse over the bottom image to zoom in on a specific region.
Figure 2a: Nucleotide distribution across amplicon. At each base in the reference amplicon, the percentage of each base as observed in sequencing reads is shown (A = green; C = orange; G = yellow; T = purple). Black bars show the percentage of reads for which that base was deleted. Brown bars between bases show the percentage of reads having an insertion at that position.

Data: Nucleotide frequency table

Figure 2b: Nucleotide distribution around the PE Extension (AACGAACACCTCATGTAATGACTAAGATG).

Data: Nucleotide frequency in quantification window

Figure 2b: Nucleotide distribution around the PE spacer sgRNA (GTCATCTTAGTCATTACCTG).

Data: Nucleotide frequency in quantification window

Figure 2b: Nucleotide distribution around the PE nicking sgRNA (CTCAACCATTAAGCAAAACAT).

Data: Nucleotide frequency in quantification window

Modification lengths for Scaffold-incorporated

Figure 3a: Frequency distribution of alleles with indels (blue) and without indels (red). Note that histograms are clipped to show 99% of the data. To show all data, run using the parameter '--plot_histogram_outliers'. (Maximum 60 not shown) (Minimum -50 not shown)

Data: Indel histogram

Figure 3b: Left panel, frequency distribution of sequence modifications that increase read length with respect to the reference amplicon, classified as insertions (positive indel size). Middle panel, frequency distribution of sequence modifications that reduce read length with respect to the reference amplicon, classified as deletions (negative indel size). Right panel, frequency distribution of sequence modifications that do not alter read length with respect to the reference amplicon, which are classified as substitutions (number of substituted positions shown). Note that histograms are clipped to show 99% of the data. To show all data, run using the parameter '--plot_histogram_outliers'. (Insertion maximum 60 not shown) (Deletion minimum -50 not shown)

Data: Insertions frequency

Data: Deletions Frequency

Data: Substitutions Frequency

Indel characterization for Scaffold-incorporated

Figure 4a: Combined frequency of any modification across the amplicon. Modifications outside of the quantification window are also shown.

Figure 4b: Frequency of insertions, deletions, and substitutions across the entire amplicon, including modifications outside of the quantification window.

Data: Modification frequency

Figure 4c: Frequency of insertions, deletions, and substitutions across the entire amplicon, considering only modifications that overlap with the quantification window.

Data: Modification frequency in quantification window

Figure 4d: Position dependent insertion size(left) and deletion size (right), including only modifications that overlap with the quantification window.

Allele plots for Scaffold-incorporated

Figure 9: Visualization of the distribution of identified alleles around the cleavage site for the PE Extension (AACGAACACCTCATGTAATGACTAAGATG). Nucleotides are indicated by unique colors (A = green; C = red; G = yellow; T = purple). Substitutions are shown in bold font. Red rectangles highlight inserted sequences. Horizontal dashed lines indicate deleted sequences. The vertical dashed line indicates the predicted cleavage site.

Data: Allele frequency table

Figure 9: Visualization of the distribution of identified alleles around the cleavage site for the PE spacer sgRNA (GTCATCTTAGTCATTACCTG). Nucleotides are indicated by unique colors (A = green; C = red; G = yellow; T = purple). Substitutions are shown in bold font. Red rectangles highlight inserted sequences. Horizontal dashed lines indicate deleted sequences. The vertical dashed line indicates the predicted cleavage site.

Data: Allele frequency table

Figure 9: Visualization of the distribution of identified alleles around the cleavage site for the PE nicking sgRNA (CTCAACCATTAAGCAAAACAT). Nucleotides are indicated by unique colors (A = green; C = red; G = yellow; T = purple). Substitutions are shown in bold font. Red rectangles highlight inserted sequences. Horizontal dashed lines indicate deleted sequences. The vertical dashed line indicates the predicted cleavage site.

Data: Allele frequency table

CRISPResso2

Analysis of genome editing outcomes from deep sequencing data

CRISPResso2 run information

Allele assignments

Prime editing report (all reads aligned to Reference)

Prime editing summary plots at analysis positions (aligned to Reference)

Scaffold insertions

Amplicons

Reads aligning to Reference

Nucleotide composition for Reference

Modification lengths for Reference

Indel characterization for Reference

Allele plots for Reference

Reads aligning to Prime-edited

Nucleotide composition for Prime-edited

Modification lengths for Prime-edited

Indel characterization for Prime-edited

Allele plots for Prime-edited

Reads aligning to Scaffold-incorporated

Nucleotide composition for Scaffold-incorporated

Modification lengths for Scaffold-incorporated

Indel characterization for Scaffold-incorporated

Allele plots for Scaffold-incorporated